version
PlantPromoterDB promoter information of AT2G03680.2

Summary of Gene (AT2G03680.2)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G03680  TAIR      NCBI 
Gene model AT2G03680.2  
Description The SPR1 gene encodes a plant-specific 12-kD protein which has a repeated motif at both ends, separated by a predicted rod-like domain, suggesting that it may act as an intermolecular linker. Ubiquitously expressed and belongs to a six-member gene family in Arabidopsis; expressed in transgenic seedlings localized to microtubules within the cortical array, preprophase band, phragmoplast, and mitotic spindle.  
#
#

Overview

Focused view (chromosome 2: 1120398-1121597)

Genome position     
from initiation codon
AT2G03670.1         
AT2G03680.1         
TSS from cDNA
TSS information
AT2G03680.2                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G03680.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA38+1120804-594

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+1120804-594
TSS cloneGclone+1120805-593
TSS cloneTclone+1120806-592
TSS cloneAclone+1120808-590
TSS cloneGclone+1120809-589

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTATAAATA+11207701120779-628-619
Y PatchCTTCTTCTCCT+11208281120838-570-560
Y PatchTTTCTTCTTC+11208431120852-555-546
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATGGCCCA+11205161120523-882-875
 AtREG437ATGGCCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATAAACCGGTTTT+11206461120658-752-740
 AtREG598ATAAACCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542     CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGTTTTGA+11207171120724-681-674
 AtREG653CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 
REGTTAAACCGGAA+11207311120741-667-657
 AtREG473TTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534   AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACCGG+11207561120763-642-635
 AtREG542AAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.