PlantPromoterDB promoter information of AT2G04780
Summary of Gene (AT2G04780)
|
Overview
|
Focused view (chromosome 2: 1675138-1676337)
|
Genome position
from initiation codon TSS from cDNA TSS information AT2G04780 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT2G04780
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 2 | + | 1676735 | -753 |
| TSS peak | A | 31 | + | 1676979 | -509 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | + | 1676742 | -746 |
| TSS clone | T | clone | + | 1676974 | -514 |
| TSS clone | A | clone | + | 1676979 | -509 |
| TSS clone | T | clone | + | 1676980 | -508 |
| TSS clone | C | clone | + | 1677011 | -477 |
| TSS clone | G | clone | + | 1677217 | -271 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CATCTCTCTTCTTCCTCCTCT | + | 1676948 | 1676968 | -540 | -520 |
| Y Patch | CTTCTCTTC | + | 1676970 | 1676978 | -518 | -510 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | AAAACGGCA | + | 1676802 | 1676810 | -686 | -678 | |||
| AtREG531 | AAAACGGC | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
| AtREG500 | AAACGGCA | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||