version
PlantPromoterDB promoter information of AT2G17380.1

Summary of Gene (AT2G17380.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G17380  TAIR      NCBI 
Gene model AT2G17380.1  
Description Encodes clathrin assembly protein AP19.  
#
#

Overview

Focused view (chromosome 2: 7552122-7553321)

Genome position     
from initiation codon
AT2G17370.1         
TSS from cDNA
TSS information
AT2G17380.1                      5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G17380.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC5+7553046-76

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+7553044-78
TSS cloneCclone+7553045-77
TSS cloneCclone+7553048-74

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCT+75530687553075-54-47
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAGTCGGACCGTCAGA+75528307552846-292-276
 AtREG582TAAGTCGG          PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG625        ACCGTCAG  PPDB Motif  PLACE Motif 
 AtREG622         CCGTCAGA PPDB Motif  PLACE Motif 
REGTTTAACGG+75528667552873-256-249
 AtREG610TTTAACGG PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGCCGACCCGGGTC+75529517552962-171-160
 AtREG375CCGACCCG     PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG494 CGACCCGG    PPDB Motif  PLACE Motif 
 AtREG593  GACCCGGGTC PPDB MotifGGGACCC  PLACE Motif 
REGCCGACCCGGG+75529817552990-141-132
 AtREG375CCGACCCG   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG494 CGACCCGG  PPDB Motif  PLACE Motif 
 AtREG593  GACCCGGG PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.