version
PlantPromoterDB promoter information of AT2G19270.1

Summary of Gene (AT2G19270.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G19270  TAIR      NCBI 
Gene model AT2G19270.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitotic checkpoint protein PRCC, C-terminal (InterPro:IPR018800); Has 1029 Blast hits to 488 proteins in 117 species: Archae - 0; Bacteria - 14; Metazoa - 432; Fungi - 124; Plants - 39; Viruses - 0; Other Eukaryotes - 420 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 8362907-8361708)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G19270.1                      5'->3' (-)
Promoter sequence


















 
AT2G19280.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G19270.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-8361948-41

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-8361955-48
TSS cloneAclone-8361954-47
TSS cloneCclone-8361950-43
TSS cloneAclone-8361947-40
TSS cloneTclone-8361937-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATAAATA-83619828361991-75-84
Y PatchTCTTCCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT-83619118361945-4-38
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAAGCCCATA-83619888361999-81-92
 AtREG589AAAAAGCC     PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477    AGCCCATA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAAATGGGCTTTTAAATGGG-83620168362034-109-127
 AtREG386AAATGGGC            PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT        PPDB MotifGCCCA  PLACE Motif 
 AtREG549     GGCTTTTA       PPDB Motif  PLACE Motif 
 AtREG443           TAAATGGG PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCCAT-83620658362075-158-168
 AtREG421ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420  TTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437   TGGGCCAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGCTTATTGG-83621928362199-285-292
 AtREG611CTTATTGG PPDB Motif  PLACE Motif 
REGCGAACCGGTTTT-83622258362236-318-329
 AtREG423CGAACCGG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528 GAACCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436   ACCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542    CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+8362435AT2G19280.1
TSS clone peakGclone+8362436AT2G19280.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.