version
PlantPromoterDB promoter information of AT2G20495.1

Summary of Gene (AT2G20495.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G20495  TAIR      NCBI 
Gene model AT2G20495.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Serine-threonine protein kinase 19 (InterPro:IPR018865); Has 119 Blast hits to 119 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 8830930-8832129)

Genome position     
from initiation codon
AT2G20490.1         
AT2G20490.2         
TSS from cDNA
TSS information
AT2G20495.1                      5'->3' (+)
Promoter sequence






 
AT2G20480.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G20495.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4-8831518AT2G20480.1
TSS peakA4+8831727AT2G20490.1, AT2G20490.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+8831723AT2G20490.1, AT2G20490.2
TSS cloneCclone+8831725AT2G20490.1, AT2G20490.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTTATATACAC+88316858831696AT2G20490.1, AT2G20490.2
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGTCACGTGTGA-88315708831580AT2G20480.1
 AtREG583GTCACGTG    PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG628 TCACGTGT  DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG460  CACGTGTG ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG588   ACGTGTGAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGGAGCCCAACT-88316008831609AT2G20480.1
 AtREG533GAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574 AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG607  GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGCAATGGGCCTAC-88316188831629AT2G20480.1
 AtREG551CAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG435    GGGCCTAC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGAAATGGGCTTTTT-88316558831667AT2G20480.1
 AtREG386AAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG589     GGCTTTTT PPDB Motif  PLACE Motif 
REGTCACACGTGAC+88315708831580AT2G20490.1, AT2G20490.2
 AtREG588TCACACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG460 CACACGTG  ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG628  ACACGTGA DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG583   CACGTGAC PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
REGAGTTGGGCTC+88316008831609AT2G20490.1, AT2G20490.2
 AtREG607AGTTGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG574 GTTGGGCT  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG533  TTGGGCTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGTAGGCCCATTG+88316188831629AT2G20490.1, AT2G20490.2
 AtREG435GTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358 TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG551    GCCCATTG PPDB MotifGCCCA  PLACE Motif 
REGAAAAAGCCCATTT+88316558831667AT2G20490.1, AT2G20490.2
 AtREG589AAAAAGCC      PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386     GCCCATTT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.