version
PlantPromoterDB promoter information of AT2G21660.1

Summary of Gene (AT2G21660.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G21660  TAIR      NCBI 
Gene model AT2G21660.1  
Description Encodes a small glycine-rich RNA binding protein that is part of a negative-feedback loop through which AtGRP7 regulates the circadian oscillations of its own transcript. Gene expression is induced by cold. GRP7 appears to promote stomatal opening and reduce tolerance under salt and dehydration stress conditions, but, promotes stomatal closing and thereby increases stress tolerance under conditions of cold tolerance. Loss of function mutations have increased susceptibility to pathogens suggesting a role in mediating innate immune response. Mutants are also late flowering in a non-photoperiodic manner and are responsive to vernalization suggesting an interaction with the autonomous flowering pathway. There is a reduction of mRNA export from the nucleus in grp7 mutants. GRP7:GFP fusion proteins can be found in the cytosol and nucleus. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase).  
#
#

Overview

Focused view (chromosome 2: 9267316-9266117)

Genome position     
from initiation codon
AT2G21660.2         
AT2G21670           
AT2G21670.1         
TSS from cDNA
TSS information
AT2G21660.1                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G21660.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA720-9266375-59

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-9266384-68
TSS cloneTclone-9266376-60
TSS cloneAclone-9266375-59
TSS cloneCclone-9266374-58
TSS cloneAclone-9266373-57
TSS cloneCclone-9266372-56
TSS cloneAclone-9266371-55
TSS cloneTclone-9266370-54
TSS cloneCclone-9266369-53

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCCTTATAAATA-92664009266411-84-95
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTAAACCGACT-92664549266464-138-148
 AtREG519GTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG641   AACCGACT PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 
REGTGTCACGTG-92665279266535-211-219
 AtREG606TGTCACGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG583 GTCACGTG PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.