PlantPromoterDB promoter information of AT2G21820

Summary of Gene (AT2G21820)

Organism	Arabidopsis thaliana
Chromosome	2
Locus	AT2G21820 TAIR NCBI
Gene model	AT2G21820
Description	unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, root, carpel, stamen, leaf; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible; Has 23 Blast hits to 23 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

#

Overview

Focused view (chromosome 2: 9304219-9303020)

`Genome position from initiation codon` `AT2G21820.1 TSS from cDNA TSS information AT2G21820 5'->3' (-) Promoter sequence AT2G21830.1 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G21820

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone peak G clone - 9303247 -28

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone peak	`G`	clone	-	9303247	-28

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 17 + 9303713 AT2G21830.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	17	+	9303713	AT2G21830.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone A clone + 9303713 AT2G21830.1

TSS clone T clone + 9303745 AT2G21830.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`A`	clone	+	9303713	AT2G21830.1
TSS clone	`T`	clone	+	9303745	AT2G21830.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTCTCTCTCTCTCT + 9303690 9303703 AT2G21830.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTCTCTCTCTCTCT`	+	9303690	9303703	AT2G21830.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG AAATGGGCTCA + 9303580 9303590 AT2G21830.1

AtREG386 AAATGGGC    PPDB Motif GCCCA PLACE Motif

AtREG372 AATGGGCT   PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG485    TGGGCTCA PPDB Motif GCCCA PLACE Motif TGGGCY