PlantPromoterDB promoter information of AT2G24090.1
Summary of Gene (AT2G24090.1)
|
Overview
|
Focused view (chromosome 2: 10241038-10242237)
|
Genome position
from initiation codon TSS from cDNA TSS information AT2G24090.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT2G24090.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 5 | + | 10241992 | -46 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | + | 10241974 | -64 |
| TSS clone | A | clone | + | 10241976 | -62 |
| TSS clone | G | clone | + | 10241993 | -45 |
| TSS clone | A | clone | + | 10241994 | -44 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TCTTCTTC | + | 10241965 | 10241972 | -73 | -66 |
| Y Patch | TCTCTTTCCT | + | 10241977 | 10241986 | -61 | -52 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GGCCTATT | + | 10241722 | 10241729 | -316 | -309 | |||
| AtREG424 | GGCCTATT | PPDB Motif | PLACE Motif | ||||||
| REG | CCCATTAA | + | 10241734 | 10241741 | -304 | -297 | |||
| AtREG396 | CCCATTAA | PPDB Motif | GCCCA | PLACE Motif | TTAATGG | ||||
| REG | GGCCTAAA | + | 10241760 | 10241767 | -278 | -271 | |||
| AtREG430 | GGCCTAAA | PPDB Motif | PLACE Motif | ||||||
| REG | TATACCGGTTTT | + | 10241871 | 10241882 | -167 | -156 | |||
| AtREG629 | TATACCGG | PPDB Motif | PLACE Motif | ||||||
| AtREG436 | ACCGGTTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG542 | CCGGTTTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | TAACCGGAATAAACCGAAGTAAACCGGAT | + | 10241887 | 10241915 | -151 | -123 | |||
| AtREG621 | TAACCGGA | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| AtREG534 | AACCGGAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG598 | ATAAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG514 | TAAACCGA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG568 | AAACCGAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG519 | GTAAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG412 | TAAACCGG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG521 | AAACCGGA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG561 | AACCGGAT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||