version
PlantPromoterDB promoter information of AT2G24090.1

Summary of Gene (AT2G24090.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G24090  TAIR      NCBI 
Gene model AT2G24090.1  
Description ribosomal protein L35 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35, conserved site (InterPro:IPR018265), Ribosomal protein L35 (InterPro:IPR001706); Has 3401 Blast hits to 3401 proteins in 1037 species: Archae - 0; Bacteria - 2119; Metazoa - 6; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1232 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 10241038-10242237)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G24090.1                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G24090.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5+10241992-46

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+10241974-64
TSS cloneAclone+10241976-62
TSS cloneGclone+10241993-45
TSS cloneAclone+10241994-44

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTTC+1024196510241972-73-66
Y PatchTCTCTTTCCT+1024197710241986-61-52
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCTATT+1024172210241729-316-309
 AtREG424GGCCTATT PPDB Motif  PLACE Motif 
REGCCCATTAA+1024173410241741-304-297
 AtREG396CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGGGCCTAAA+1024176010241767-278-271
 AtREG430GGCCTAAA PPDB Motif  PLACE Motif 
REGTATACCGGTTTT+1024187110241882-167-156
 AtREG629TATACCGG     PPDB Motif  PLACE Motif 
 AtREG436   ACCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542    CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAACCGGAATAAACCGAAGTAAACCGGAT+1024188710241915-151-123
 AtREG621TAACCGGA                      PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG534 AACCGGAA                     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598        ATAAACCG              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514         TAAACCGA             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568          AAACCGAA            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG519                  GTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412                   TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521                    AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561                     AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.