PlantPromoterDB promoter information of AT2G25840.2

Summary of Gene (AT2G25840.2)

Organism	Arabidopsis thaliana
Chromosome	2
Locus	AT2G25840 TAIR NCBI
Gene model	AT2G25840.2
Description	ovule abortion 4 (OVA4); FUNCTIONS IN: tryptophan-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: ovule development, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tryptophanyl-tRNA synthetase, class Ib (InterPro:IPR002306), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 6388 Blast hits to 6380 proteins in 1519 species: Archae - 60; Bacteria - 2910; Metazoa - 123; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 3189 (source: NCBI BLink).

#

Overview

Focused view (chromosome 2: 11037224-11038423)

`Genome position from initiation codon` `AT2G25890.1 TSS from cDNA TSS information AT2G25840.2 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G25840.2

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 8 + 11021901 -23

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	8	+	11021901	-23

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone G clone + 11021905 -19

TSS clone A clone + 11021906 -18

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`G`	clone	+	11021905	-19
TSS clone	`A`	clone	+	11021906	-18

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box CTTATAAACC + 11021868 11021877 -56 -47

Y Patch TCTTCTTCTTC + 11021882 11021892 -42 -32

Y Patch TCTCTCTC + 11021941 11021948 17 24

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CTTATAAACC`	+	11021868	11021877	-56	-47
Y Patch	`TCTTCTTCTTC`	+	11021882	11021892	-42	-32
Y Patch	`TCTCTCTC`	+	11021941	11021948	17	24
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG CCGCGTGA + 11021827 11021834 -97 -90

AtREG502 CCGCGTGA Drought PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`CCGCGTGA`		+	11021827	11021834	-97	-90
	AtREG502	`CCGCGTGA`	Drought	PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 4 + 11037352 AT2G25890.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	4	+	11037352	AT2G25890.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone C clone + 11037410 AT2G25890.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`C`	clone	+	11037410	AT2G25890.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CCTCTCCTTC + 11037314 11037323 AT2G25890.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CCTCTCCTTC`	+	11037314	11037323	AT2G25890.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CCGCGTGA + 11037247 11037254 AT2G25890.1

AtREG502 CCGCGTGA Drought PPDB Motif PLACE Motif

REG TCGTCGTT + 11037281 11037288 AT2G25890.1

AtREG648 TCGTCGTT PPDB Motif PLACE Motif