version
PlantPromoterDB promoter information of AT2G25840.3

Summary of Gene (AT2G25840.3)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G25840  TAIR      NCBI 
Gene model AT2G25840.3  
Description ovule abortion 4 (OVA4); FUNCTIONS IN: tryptophan-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: ovule development, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tryptophanyl-tRNA synthetase, class Ib (InterPro:IPR002306), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 6388 Blast hits to 6380 proteins in 1519 species: Archae - 60; Bacteria - 2910; Metazoa - 123; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 3189 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 11030074-11031273)

Genome position     
from initiation codon
AT2G25870.1         
TSS from cDNA
TSS information
AT2G25840.3                      5'->3' (+)
Promoter sequence





 
AT2G25850.1         
AT2G25850.2         
AT2G25850.3         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G25840.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+11021901-23

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+11021905-19
TSS cloneAclone+11021906-18

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTATAAACC+1102186811021877-56-47
Y PatchTCTTCTTCTTC+1102188211021892-42-32
Y PatchTCTCTCTC+11021941110219481724
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGCGTGA+1102182711021834-97-90
 AtREG502CCGCGTGADrought PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2-11030757AT2G25850.2, AT2G25850.1, AT2G25850.3
TSS peakG2-11030684AT2G25850.2, AT2G25850.1, AT2G25850.3
TSS peakG10+11031121AT2G25870.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-11030627AT2G25850.2, AT2G25850.1, AT2G25850.3
TSS cloneTclone+11031094AT2G25870.1
TSS cloneAclone+11031115AT2G25870.1
TSS cloneTclone+11031120AT2G25870.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCCTTCTCTCCC-1103076411030779AT2G25850.1, AT2G25850.2, AT2G25850.3
Y PatchCCTCCTTCTCTC+1103113011031141AT2G25870.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACCGGGTT-1103086511030872AT2G25850.1, AT2G25850.2, AT2G25850.3
 AtREG516ACCGGGTT PPDB Motif  PLACE Motif 
REGCGAACCGGAAA-1103091011030920AT2G25850.1, AT2G25850.2, AT2G25850.3
 AtREG423CGAACCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 GAACCGGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534  AACCGGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644   ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAAACCGGAT-1103092811030938AT2G25850.1, AT2G25850.2, AT2G25850.3
 AtREG473TTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAAACCGGAT-1103102811031038AT2G25850.1, AT2G25850.2, AT2G25850.3
 AtREG598ATAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACCCGGT+1103086511030872AT2G25870.1
 AtREG516AACCCGGT PPDB Motif  PLACE Motif 
REGTTTCCGGTTCG+1103091011030920AT2G25870.1
 AtREG644TTTCCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579  TCCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423   CCGGTTCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGATCCGGTTTAA+1103092811030938AT2G25870.1
 AtREG561ATCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473   CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGATCCGGTTTAT+1103102811031038AT2G25870.1
 AtREG561ATCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598   CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGTTTAG+1103105211031061AT2G25870.1
 AtREG568TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511  CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.