PlantPromoterDB promoter information of AT2G26430.3
Summary of Gene (AT2G26430.3)
|
Overview
|
Focused view (chromosome 2: 11252405-11251206)
|
Genome position
from initiation codon TSS from cDNA TSS information AT2G26430.3 5'->3' (-) Promoter sequence AT2G26450.1
TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT2G26430.3
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 7 | - | 11246028 | -773 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | C | clone | - | 11246035 | -780 |
| TSS clone | A | clone | - | 11246025 | -770 |
| TSS clone | A | clone | - | 11246018 | -763 |
| TSS clone | T | clone | - | 11246004 | -749 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CCTCTTCTCGTCTCTC | - | 11245986 | 11246001 | -731 | -746 |
| Y Patch | TTCTCTTCTT | - | 11246048 | 11246057 | -793 | -802 |
| Y Patch | TTCTTCCT | - | 11246068 | 11246075 | -813 | -820 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GTAGGCCCAATTA | - | 11246083 | 11246095 | -828 | -840 | |||
| AtREG435 | GTAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG358 | TAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG356 | AGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG352 | GGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG418 | GCCCAATT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG600 | CCCAATTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | CTAAGCCCAATAAGGGCCTAG | - | 11246101 | 11246121 | -846 | -866 | |||
| AtREG634 | CTAAGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG426 | TAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG407 | AAGCCCAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG402 | AGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG355 | GCCCAATA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG417 | CCCAATAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG611 | CCAATAAG | PPDB Motif | PLACE Motif | ||||||
| AtREG616 | ATAAGGGC | PPDB Motif | PLACE Motif | ||||||
| AtREG475 | GGGCCTAG | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS peak | A | 5 | + | 11251207 | AT2G26450.1 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TCTTTCTCTCCC | + | 11251221 | 11251232 | AT2G26450.1 | |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||