PlantPromoterDB promoter information of AT2G26690

Summary of Gene (AT2G26690)

Organism	Arabidopsis thaliana
Chromosome	2
Locus	AT2G26690 TAIR NCBI
Gene model	AT2G26690
Description	nitrate transporter (NTP2); FUNCTIONS IN: transporter activity; INVOLVED IN: response to jasmonic acid stimulus, response to wounding; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: NRT1.1; nitrate transmembrane transporter/ transporter (TAIR:AT1G12110.1); Has 4204 Blast hits to 4131 proteins in 765 species: Archae - 0; Bacteria - 1892; Metazoa - 433; Fungi - 280; Plants - 1124; Viruses - 0; Other Eukaryotes - 475 (source: NCBI BLink).

#

Overview

Focused view (chromosome 2: 11344466-11343267)

`Genome position from initiation codon` `AT2G26680.1 TSS from cDNA TSS information AT2G26690 5'->3' (-) Promoter sequence AT2G26670.1 AT2G26670.2 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G26690

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 2 - 11351124 -208

TSS peak G 17 - 11350987 -71

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	2	-	11351124	-208
TSS peak	`G`	17	-	11350987	-71

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone G clone - 11350993 -77

TSS clone C clone - 11350992 -76

TSS clone G clone - 11350987 -71

TSS clone G clone - 11350984 -68

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`G`	clone	-	11350993	-77
TSS clone	`C`	clone	-	11350992	-76
TSS clone	`G`	clone	-	11350987	-71
TSS clone	`G`	clone	-	11350984	-68

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box GGCTATAAAAA - 11351019 11351029 -103 -113

TATA Box AATATAAATT - 11351155 11351164 -239 -248

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`GGCTATAAAAA`	-	11351019	11351029	-103	-113
TATA Box	`AATATAAATT`	-	11351155	11351164	-239	-248
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TGGGACCCA - 11351273 11351281 -357 -365

AtREG596 TGGGACCC PPDB Motif GGGACCC PLACE Motif

AtREG615 GGGACCCA ABA PPDB Motif GGGACCC PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TGGGACCCA`		-	11351273	11351281	-357	-365
	AtREG596	`TGGGACCC`		PPDB Motif	`GGGACCC`	PLACE Motif
	AtREG615	`GGGACCCA`	ABA	PPDB Motif	`GGGACCC`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None