version
PlantPromoterDB promoter information of AT2G28450.1

Summary of Gene (AT2G28450.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G28450  TAIR      NCBI 
Gene model AT2G28450.1  
Description zinc finger (CCCH-type) family protein; FUNCTIONS IN: methyltransferase activity, zinc ion binding, RNA methyltransferase activity, nucleic acid binding; INVOLVED IN: acetate biosynthetic process from carbon monoxide, methanol oxidation, RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Methyltransferase small (InterPro:IPR007848), (Uracil-5)-methyltransferase (InterPro:IPR010280); BEST Arabidopsis thaliana protein match is: RNA methyltransferase family protein (TAIR:AT3G21300.1); Has 4397 Blast hits to 3845 proteins in 1016 species: Archae - 74; Bacteria - 3383; Metazoa - 309; Fungi - 76; Plants - 54; Viruses - 3; Other Eukaryotes - 498 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 12166761-12165562)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G28450.1                      5'->3' (-)
Promoter sequence




 
AT2G28460.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G28450.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13-12165914-153

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-12165913-152
TSS cloneAclone-12165894-133

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTAAACCGAA-1216600012166009-239-248
 AtREG511CTAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAAACCGGAAA-1216603512166045-274-284
 AtREG496CAAACCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534  AACCGGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644   ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.