PlantPromoterDB promoter information of AT2G29400.1
Summary of Gene (AT2G29400.1)
|
Overview
|
Focused view (chromosome 2: 12616283-12615084)
|
Genome position
from initiation codon TSS from cDNA TSS information AT2G29400.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT2G29400.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 26 | - | 12615389 | -106 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | - | 12615398 | -115 |
| TSS clone | T | clone | - | 12615395 | -112 |
| TSS clone | A | clone | - | 12615389 | -106 |
| TSS clone | A | clone | - | 12615388 | -105 |
| TSS clone | C | clone | - | 12615386 | -103 |
| TSS clone | T | clone | - | 12615385 | -102 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TCTCTCCTCCTC | - | 12615350 | 12615361 | -67 | -78 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CCCATTAG | - | 12615455 | 12615462 | -172 | -179 | |||
| AtREG558 | CCCATTAG | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | ACGTGTAC | - | 12615466 | 12615473 | -183 | -190 | |||
| AtREG562 | ACGTGTAC | ABA, Auxin | PPDB Motif | ACGT | PLACE Motif | ACGT, ACGTG | |||
| REG | TAGCCCATTTACAGGCCCAATAA | - | 12615475 | 12615497 | -192 | -214 | |||
| AtREG581 | TAGCCCAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG372 | AGCCCATT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG386 | GCCCATTT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG443 | CCCATTTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG433 | ACAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG370 | CAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG356 | AGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG352 | GGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG355 | GCCCAATA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG417 | CCCAATAA | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||