version
PlantPromoterDB promoter information of AT2G29550.1

Summary of Gene (AT2G29550.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G29550  TAIR      NCBI 
Gene model AT2G29550.1  
Description Encodes a beta-tubulin that is expressed in leaves, roots and flowers.  
#
#

Overview

Focused view (chromosome 2: 12646932-12645733)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G29550.1                      5'->3' (-)
Promoter sequence














 
AT2G29560.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence














 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G29550.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-12646035-103

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-12646067-135
TSS cloneCclone-12646038-106
TSS cloneAclone-12646037-105
TSS cloneTclone-12646036-104
TSS cloneAclone-12646035-103
TSS cloneCclone-12646003-71
TSS cloneAclone-12645963-31
TSS cloneAclone-12645939-7

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTTTATAAATG-1264606212646073-130-141
Y PatchCTTCTCCTTTC-1264600512646015-73-83
Y PatchTCCTCTCT-1264601712646024-85-92
Y PatchCCTCCTCTTCTTCTCTCTCTCAT-1264603612646058-104-126
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTTAAA-1264608312646090-151-158
 AtREG610CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGCTAAACCGT-1264612012646128-188-196
 AtREG511CTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG652 TAAACCGT PPDB Motif  PLACE Motif 
REGTACGTGGCAT-1264613212646141-200-209
 AtREG413TACGTGGC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG379 ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG448  CGTGGCATABA, DREB1Aox PPDB Motif  PLACE MotifGCCAC 
REGCTTAATGG-1264624712646254-315-322
 AtREG604CTTAATGG PPDB Motif  PLACE MotifTTAATGG 
REGCACGTGCG-1264628412646291-352-359
 AtREG541CACGTGCG PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA2+12646560AT2G29560.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+12646589AT2G29560.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGCACGTG+1264628412646291AT2G29560.1
 AtREG541CGCACGTG PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
REGCGCACGTG+1264633012646337AT2G29560.1
 AtREG541CGCACGTG PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
REGCTTATTGGGCCTAAAATGGGCTTTTA+1264634612646371AT2G29560.1
 AtREG611CTTATTGG                   PPDB Motif  PLACE Motif 
 AtREG417 TTATTGGG                  PPDB MotifGCCCA  PLACE Motif 
 AtREG355  TATTGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG352   ATTGGGCC                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356    TTGGGCCT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358     TGGGCCTA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360      GGGCCTAA             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430       GGCCTAAA            PPDB Motif  PLACE Motif 
 AtREG386             AAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG372              AATGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378               ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376                TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409                 GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG549                  GGCTTTTA PPDB Motif  PLACE Motif 
REGCTTATTGG+1264648712646494AT2G29560.1
 AtREG611CTTATTGG PPDB Motif  PLACE Motif 
REGTGAACCGGA+1264649912646507AT2G29560.1
 AtREG480TGAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 GAACCGGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGAACCGGA+1264651112646519AT2G29560.1
 AtREG480TGAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 GAACCGGA PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.