PlantPromoterDB promoter information of AT2G29650.2
Summary of Gene (AT2G29650.2)
|
Overview
|
Focused view (chromosome 2: 12677003-12675804)
|
Genome position
from initiation codon AT2G29650.3 TSS from cDNA TSS information AT2G29650.2 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT2G29650.2
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 8 | - | 12676025 | -22 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | - | 12676049 | -46 |
| TSS clone | G | clone | - | 12676025 | -22 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTCTTCTT | - | 12675983 | 12675990 | 20 | 13 |
| Y Patch | TTCCTCTCTCTT | - | 12676055 | 12676066 | -52 | -63 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | ATTTGGGCCTTATATGGGCTTTAT | - | 12676206 | 12676229 | -203 | -226 | |||
| AtREG421 | ATTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG373 | TTTGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG356 | TTGGGCCT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG353 | TGGGCCTT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG351 | GGGCCTTA | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG425 | GGCCTTAT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG620 | TATATGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG432 | ATATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG477 | TATGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG378 | ATGGGCTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG376 | TGGGCTTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG365 | GGGCTTTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG601 | GGCTTTAT | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone | T | clone | - | 12675938 | AT2G29650.3 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||