PlantPromoterDB promoter information of AT2G33845.1

Summary of Gene (AT2G33845.1)

Organism	Arabidopsis thaliana
Chromosome	2
Locus	AT2G33845 TAIR NCBI
Gene model	AT2G33845.1
Description	DNA-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT4G28440.1); Has 158 Blast hits to 158 proteins in 34 species: Archae - 14; Bacteria - 0; Metazoa - 2; Fungi - 4; Plants - 99; Viruses - 26; Other Eukaryotes - 13 (source: NCBI BLink).

#

Overview

Focused view (chromosome 2: 14309631-14310830)

`Genome position from initiation codon` `TSS from cDNA TSS information AT2G33845.1 5'->3' (+) Promoter sequence AT2G33830.1 AT2G33830.2 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G33845.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone peak A clone + 14317676 -105

TSS clone peak A clone + 14317703 -78

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone peak	`A`	clone	+	14317676	-105
TSS clone peak	`A`	clone	+	14317703	-78

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 115 - 14310339 AT2G33830.1, AT2G33830.2

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	115	-	14310339	AT2G33830.1, AT2G33830.2

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone C clone - 14310351 AT2G33830.1, AT2G33830.2

TSS clone A clone - 14310339 AT2G33830.1, AT2G33830.2

TSS clone C clone - 14310338 AT2G33830.1, AT2G33830.2

TSS clone C clone - 14310333 AT2G33830.1, AT2G33830.2

TSS clone A clone - 14310327 AT2G33830.1, AT2G33830.2

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`C`	clone	-	14310351	AT2G33830.1, AT2G33830.2
TSS clone	`A`	clone	-	14310339	AT2G33830.1, AT2G33830.2
TSS clone	`C`	clone	-	14310338	AT2G33830.1, AT2G33830.2
TSS clone	`C`	clone	-	14310333	AT2G33830.1, AT2G33830.2
TSS clone	`A`	clone	-	14310327	AT2G33830.1, AT2G33830.2

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box GTCTATAAATT - 14310365 14310375 AT2G33830.1, AT2G33830.2

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`GTCTATAAATT`	-	14310365	14310375	AT2G33830.1, AT2G33830.2
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG GGGTCAAA - 14310439 14310446 AT2G33830.1, AT2G33830.2

AtREG592 GGGTCAAA PPDB Motif PLACE Motif TTGAC, TTGACC