version
PlantPromoterDB promoter information of AT2G34250.2

Summary of Gene (AT2G34250.2)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G34250  TAIR      NCBI 
Gene model AT2G34250.2  
Description protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 14461635-14462834)

Genome position     
from initiation codon
AT2G34240.1         
AT2G34250.1         
TSS from cDNA
TSS information
AT2G34250.2                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G34250.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA31+14462118-517

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+14462059-576
TSS cloneAclone+14462095-540
TSS cloneCclone+14462097-538
TSS cloneGclone+14462101-534
TSS cloneTclone+14462102-533
TSS cloneCclone+14462103-532
TSS cloneAclone+14462115-520
TSS cloneTclone+14462116-519
TSS cloneAclone+14462118-517
TSS cloneAclone+14462121-514
TSS cloneAclone+14462125-510
TSS cloneAclone+14462128-507
TSS cloneGclone+14462191-444
TSS cloneAclone+14462192-443

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTTCTCC+1446213114462140-504-495
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCGTTTA+1446186414461871-771-764
 AtREG565GTCGTTTA PPDB Motif  PLACE Motif 
REGCAAAGCCCATTTGACCC+1446190514461921-730-714
 AtREG559CAAAGCCC          PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372   AGCCCATT       PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386    GCCCATTT      PPDB MotifGCCCA  PLACE Motif 
 AtREG592         TTTGACCC PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGATCGGCCCAAT+1446193914461949-696-686
 AtREG555ATCGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG393 TCGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414  CGGCCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGACGTGGCAG+1446198114461990-654-645
 AtREG388GACGTGGC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG379 ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG468  CGTGGCAGABA PPDB Motif  PLACE MotifGCCAC 
REGTCGCCACG+1446203514462042-600-593
 AtREG471TCGCCACGABA PPDB Motif  PLACE MotifGCCAC 
REGAATACCCT+1446205014462057-585-578
 AtREG567AATACCCT PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.