version
PlantPromoterDB promoter information of AT2G35520.2

Summary of Gene (AT2G35520.2)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G35520  TAIR      NCBI 
Gene model AT2G35520.2  
Description DEFENDER AGAINST CELL DEATH 2 (DAD2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defender against death DAD protein (InterPro:IPR003038); BEST Arabidopsis thaliana protein match is: ATDAD1 (DEFENDER AGAINST APOPTOTIC DEATH 1) (TAIR:AT1G32210.1); Has 338 Blast hits to 338 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 77; Plants - 74; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 14920587-14921786)

Genome position     
from initiation codon
AT2G35520.1         
TSS from cDNA
TSS information
AT2G35520.2                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G35520.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+14921497-90

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+14921522-65
TSS cloneGclone+14921534-53

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGGCG+1492139314921401-194-186
 AtREG531AAAACGGC  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG524 AAACGGCG PPDB MotifAAACG(C/G)  PLACE Motif 
REGCTTGGGCCCAAAGGCCC+1492142914921445-158-142
 AtREG505CTTGGGCC          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422  TGGGCCCA        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392 TTGGGCCCAA       PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373    GGCCCAAA      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG656        CAAAGGCC  PPDB Motif  PLACE Motif 
 AtREG359         AAAGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.