version
PlantPromoterDB promoter information of AT2G36000.2

Summary of Gene (AT2G36000.2)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G36000  TAIR      NCBI 
Gene model AT2G36000.2  
Description mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 15116181-15117380)

Genome position     
from initiation codon
AT2G35990.1         
AT2G35990.2         
AT2G35990.3         
AT2G36000.1         
TSS from cDNA
TSS information
AT2G36000.2                      5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G36000.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13+15117098-83

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+15117109-72
TSS cloneTclone+15117110-71

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCCTTCTC+1511705815117069-123-112
Y PatchCCTTCTTC+1511712315117130-58-51
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAGGCCCAATGGGCTTG+1511692315116940-258-241
 AtREG587TGAGGCCC           PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG447 GAGGCCCA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG461    GCCCAATG       PPDB MotifGCCCA  PLACE Motif 
 AtREG551       CAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372        AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378         ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG525          TGGGCTTG PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATAAACCGGTTAAA+1511700515117018-176-163
 AtREG598ATAAACCG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503    ACCGGTTA   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501     CCGGTTAA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG645      CGGTTAAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTTAAACCGGAT+1511702615117036-155-145
 AtREG473TTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.