version
PlantPromoterDB promoter information of AT2G36230.1

Summary of Gene (AT2G36230.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G36230  TAIR      NCBI 
Gene model AT2G36230.1  
Description Encodes a BBMII isomerase involved in histidine biosynthesis.  
#
#

Overview

Focused view (chromosome 2: 15196509-15195310)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G36230.1                      5'->3' (-)
Promoter sequence






 
AT2G36240.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G36230.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-15195531-22

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-15195534-25
TSS cloneCclone-15195533-24
TSS cloneAclone-15195530-21

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAAACCGGAATAAACCGA-1519558115195599-72-90
 AtREG550CCAAACCG            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496 CAAACCGG           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534   AACCGGAA         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598          ATAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514           TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGTTGGGC-1519562515195632-116-123
 AtREG543TGTTGGGC PPDB MotifGCCCA  PLACE MotifCAACA 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA2+15195651AT2G36240.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+15195653AT2G36240.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAATTGGG+1519548615195493AT2G36240.1
 AtREG600TAATTGGG PPDB MotifGCCCA  PLACE Motif 
REGTCTAGGGT+1519556615195573AT2G36240.1
 AtREG658TCTAGGGT PPDB MotifACCCT  PLACE Motif 
REGTCGGTTTATTCCGGTTTGG+1519558115195599AT2G36240.1
 AtREG514TCGGTTTA            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598 CGGTTTAT           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534        TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521         TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496          CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550           CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.