version
PlantPromoterDB promoter information of AT2G36890.1

Summary of Gene (AT2G36890.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G36890  TAIR      NCBI 
Gene model AT2G36890.1  
Description "Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB38, regulates axillary meristem formation. "  
#
#

Overview

Focused view (chromosome 2: 15480621-15481820)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G36890.1                      5'->3' (+)
Promoter sequence

 
AT2G36880.1         
AT2G36880.2         
AT2G36881.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G36890.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5+15485719-102

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTTCTCTTTC+1548574715485760-74-61
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG95-15481402AT2G36880.1, AT2G36880.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-15481407AT2G36880.1, AT2G36880.2
TSS cloneGclone-15481404AT2G36880.1, AT2G36880.2
TSS cloneAclone-15481403AT2G36880.1, AT2G36880.2
TSS cloneGclone-15481402AT2G36880.1, AT2G36880.2
TSS cloneCclone-15481401AT2G36880.1, AT2G36880.2
TSS cloneGclone-15481400AT2G36880.1, AT2G36880.2
TSS cloneGclone-15481399AT2G36880.1, AT2G36880.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCAATATAAACC-1548142915481439AT2G36880.1, AT2G36880.2
Y PatchCTCCTCCT-1548171115481718AT2G36880.1, AT2G36880.2, AT2G36881.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAACACGTGA-1548145515481463AT2G36880.1, AT2G36880.2
 AtREG590AACACGTG ABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG628 ACACGTGADREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGCAACGGTC-1548149315481500AT2G36880.1, AT2G36880.2
 AtREG553CAACGGTCAuxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
REGCCGGGTCGGGT-1548161715481627AT2G36880.1, AT2G36880.2
 AtREG494CCGGGTCG    PPDB Motif  PLACE Motif 
 AtREG375 CGGGTCGG   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442  GGGTCGGG  PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405   GGTCGGGT PPDB MotifCCGAC  PLACE MotifCCGAC 
REGTAATTACG-1548163815481645AT2G36880.1, AT2G36880.2
 AtREG646TAATTACGABA PPDB Motif  PLACE Motif 
REGATCCGGTTCGG-1548166215481672AT2G36880.1, AT2G36880.2
 AtREG561ATCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 TCCGGTTC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423  CCGGTTCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456   CGGTTCGG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.