version
PlantPromoterDB promoter information of AT2G36890.1

Summary of Gene (AT2G36890.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G36890  TAIR      NCBI 
Gene model AT2G36890.1  
Description "Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB38, regulates axillary meristem formation. "  
#
#

Overview

Focused view (chromosome 2: 15483771-15484970)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G36890.1                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G36890.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5+15485719-102

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTTCTCTTTC+1548574715485760-74-61
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAACGGCAGCGTTTTA-1548378015483796AT2G36885.1, AT2G36885.2
 AtREG531AAAACGGC          PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG500 AAACGGCA         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG626       CAGCGTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564         GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGGTCACGTGGG-1548383115483840AT2G36885.1, AT2G36885.2
 AtREG583GTCACGTG   PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG464  CACGTGGGABA, Auxin, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
REGTGTTGGGCT-1548393015483938AT2G36885.1, AT2G36885.2
 AtREG543TGTTGGGC  PPDB MotifGCCCA  PLACE MotifCAACA 
 AtREG574 GTTGGGCT PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
REGTAAGGGTA-1548394915483956AT2G36885.1, AT2G36885.2
 AtREG570TAAGGGTA PPDB MotifACCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.