PlantPromoterDB promoter information of AT2G36990.1
Summary of Gene (AT2G36990.1)
|
Overview
|
Focused view (chromosome 2: 15541016-15539817)
|
Genome position
from initiation codon TSS from cDNA TSS information AT2G36990.1 5'->3' (-) Promoter sequence AT2G37000.1
TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT2G36990.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 4 | - | 15540185 | -169 |
| TSS peak | A | 4 | - | 15540093 | -77 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | G | clone | - | 15540139 | -123 |
| TSS clone | T | clone | - | 15540138 | -122 |
| TSS clone | T | clone | - | 15540134 | -118 |
| TSS clone | A | clone | - | 15540093 | -77 |
| TSS clone | T | clone | - | 15540092 | -76 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TTCTTCTTCTTCCT | - | 15540071 | 15540084 | -55 | -68 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | ATTTGGGCTTTTAAGCCCAATATAAGGCCCAACA | - | 15540239 | 15540272 | -223 | -256 | |||
| AtREG421 | ATTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG469 | TTTGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG376 | TGGGCTTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG409 | GGGCTTTT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG549 | GGCTTTTA | PPDB Motif | PLACE Motif | ||||||
| AtREG426 | TAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG407 | TTGGGCTT AAGCCCAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG402 | AGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG355 | GCCCAATA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG509 | CCCAATAT | PPDB Motif | PLACE Motif | ||||||
| AtREG425 | ATAAGGCC | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG351 | TAAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG353 | AAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG356 | AGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG449 | GGCCCAAC | PPDB Motif | GCCCA, CCAACGG | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG543 | GCCCAACA | PPDB Motif | GCCCA | PLACE Motif | CAACA | ||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||