PlantPromoterDB promoter information of AT2G40090.1
Summary of Gene (AT2G40090.1)
|
Overview
|
Focused view (chromosome 2: 16741303-16740104)
|
Genome position
from initiation codon TSS from cDNA TSS information AT2G40090.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT2G40090.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 2 | - | 16740366 | -63 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | C | clone | - | 16740365 | -62 |
| TSS clone | C | clone | - | 16740315 | -12 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TTCTCCTCC | - | 16740341 | 16740349 | -38 | -46 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CAAGCCCAATAAGTAAGGCCCACA | - | 16740445 | 16740468 | -142 | -165 | |||
| AtREG525 | CAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG407 | AAGCCCAA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG402 | AGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG355 | GCCCAATA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG417 | CCCAATAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG611 | CCAATAAG | PPDB Motif | PLACE Motif | ||||||
| AtREG530 | GTAAGGCC | PPDB Motif | PLACE Motif | ||||||
| AtREG351 | TAAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG353 | AAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG482 | AGGCCCAC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG612 | GGCCCACA | DREB1Aox | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | |||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||