version
PlantPromoterDB promoter information of AT2G40180.1

Summary of Gene (AT2G40180.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G40180  TAIR      NCBI 
Gene model AT2G40180.1  
Description ATHPP2C5; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT2G30020.1); Has 4428 Blast hits to 4380 proteins in 326 species: Archae - 4; Bacteria - 211; Metazoa - 1380; Fungi - 537; Plants - 1317; Viruses - 9; Other Eukaryotes - 970 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 16781522-16782721)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G40180.1                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G40180.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGC+1678225016782257-272-265
 AtREG421ATTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTCGTCGTT+1678234716782354-175-168
 AtREG648TCGTCGTT PPDB Motif  PLACE Motif 
REGGCCCACTA+1678240116782408-121-114
 AtREG532GCCCACTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.