version
PlantPromoterDB promoter information of AT2G40310.1

Summary of Gene (AT2G40310.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G40310  TAIR      NCBI 
Gene model AT2G40310.1  
Description glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectin lyase fold (InterPro:IPR012334), Glycoside hydrolase, family 28 (InterPro:IPR000743), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: polygalacturonase (TAIR:AT4G13760.1); Has 2349 Blast hits to 2340 proteins in 292 species: Archae - 2; Bacteria - 417; Metazoa - 8; Fungi - 973; Plants - 878; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 16833065-16834264)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G40310.1                      5'->3' (+)
Promoter sequence

 
AT2G40300.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G40310.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA26-16833280AT2G40300.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-16833280AT2G40300.1
TSS cloneTclone-16833279AT2G40300.1
TSS cloneTclone-16833275AT2G40300.1
TSS cloneCclone-16833240AT2G40300.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATATCT-1683330216833309AT2G40300.1
Y PatchCGTCTTCTCC-1683326816833277AT2G40300.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGTACACGTGTCT-1683335516833366AT2G40300.1
 AtREG562GTACACGT    ABA, Auxin PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG453 TACACGTG   ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
 AtREG366   CACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG470    ACGTGTCTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
REGTTGCCACGCGCC-1683339116833402AT2G40300.1
 AtREG452TTGCCACG     PPDB Motif  PLACE MotifGCCAC 
 AtREG486    CACGCGCC PPDB MotifACGCGC  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.