PlantPromoterDB promoter information of AT2G41410

Summary of Gene (AT2G41410)

Organism	Arabidopsis thaliana
Chromosome	2
Locus	AT2G41410 TAIR NCBI
Gene model	AT2G41410
Description	calmodulin, putative; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin, putative (TAIR:AT3G10190.1); Has 10198 Blast hits to 7608 proteins in 1056 species: Archae - 0; Bacteria - 38; Metazoa - 4396; Fungi - 1728; Plants - 2446; Viruses - 0; Other Eukaryotes - 1590 (source: NCBI BLink).

#

Overview

Focused view (chromosome 2: 17263735-17262536)

`Genome position from initiation codon` `AT2G41410.1 TSS from cDNA TSS information AT2G41410 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G41410

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 8 - 17262884 -149

TSS peak A 8 - 17262788 -53

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	8	-	17262884	-149
TSS peak	`A`	8	-	17262788	-53

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone - 17262907 -172

TSS clone C clone - 17262886 -151

TSS clone T clone - 17262885 -150

TSS clone G clone - 17262883 -148

TSS clone A clone - 17262806 -71

TSS clone A clone - 17262805 -70

TSS clone T clone - 17262762 -27

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	-	17262907	-172
TSS clone	`C`	clone	-	17262886	-151
TSS clone	`T`	clone	-	17262885	-150
TSS clone	`G`	clone	-	17262883	-148
TSS clone	`A`	clone	-	17262806	-71
TSS clone	`A`	clone	-	17262805	-70
TSS clone	`T`	clone	-	17262762	-27

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCTTCTTCTCC - 17262739 17262749 -4 -14

Y Patch CATCTCTCTTTCT - 17262752 17262764 -17 -29

Y Patch TCTTTCCTCTC - 17262807 17262817 -72 -82

Y Patch CCTCCTTCCTC - 17262820 17262830 -85 -95

Y Patch CTTCTCTCTTTCTCTCCC - 17262841 17262858 -106 -123

Y Patch CTTCTCTCCT - 17262885 17262894 -150 -159

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCTTCTTCTCC`	-	17262739	17262749	-4	-14
Y Patch	`CATCTCTCTTTCT`	-	17262752	17262764	-17	-29
Y Patch	`TCTTTCCTCTC`	-	17262807	17262817	-72	-82
Y Patch	`CCTCCTTCCTC`	-	17262820	17262830	-85	-95
Y Patch	`CTTCTCTCTTTCTCTCCC`	-	17262841	17262858	-106	-123
Y Patch	`CTTCTCTCCT`	-	17262885	17262894	-150	-159
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG CCCATTTAATACCCT - 17262828 17262842 -93 -107

AtREG443 CCCATTTA PPDB Motif GCCCA PLACE Motif

AtREG567 AATACCCT PPDB Motif ACCCT PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`CCCATTTAATACCCT`		-	17262828	17262842	-93	-107
	AtREG443	`CCCATTTA`		PPDB Motif	`GCCCA`	PLACE Motif
	AtREG567	`AATACCCT`		PPDB Motif	`ACCCT`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None