version
PlantPromoterDB promoter information of AT2G42120.1

Summary of Gene (AT2G42120.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G42120  TAIR      NCBI 
Gene model AT2G42120.1  
Description DNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 17566965-17565766)

Genome position     
from initiation codon
AT2G42120.2         
TSS from cDNA
TSS information
AT2G42120.1                      5'->3' (-)
Promoter sequence







 
AT2G42130.1         
AT2G42130.2         
AT2G42130.3         
AT2G42130.4         
AT2G42130.5         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G42120.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-17566035-70

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-17566032-67

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAACCGGGTT-1756608717566097-122-132
 AtREG501TTAACCGG    PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG455  AACCGGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG516   ACCGGGTT PPDB Motif  PLACE Motif 
REGACCGGTTTATATCCGGTTCAA-1756611417566134-149-169
 AtREG436ACCGGTTT              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 CCGGTTTA             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598  CGGTTTAT            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561          ATCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579           TCCGGTTC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480            CCGGTTCA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG640             CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACCGAACCA-1756625617566265-291-300
 AtREG556AACCGAAC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451 ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655  CCGAACCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2+17566181AT2G42130.1, AT2G42130.4, AT2G42130.3, AT2G42130.5, AT2G42130.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTTCTTCT+1756621817566229AT2G42130.1, AT2G42130.2, AT2G42130.3, AT2G42130.4, AT2G42130.5
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAACCCGGTTAA+1756608717566097AT2G42130.1, AT2G42130.2, AT2G42130.3, AT2G42130.4, AT2G42130.5
 AtREG516AACCCGGT    PPDB Motif  PLACE Motif 
 AtREG455 ACCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG501   CCGGTTAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTTGAACCGGATATAAACCGGT+1756611417566134AT2G42130.1, AT2G42130.2, AT2G42130.3, AT2G42130.4, AT2G42130.5
 AtREG640TTGAACCG              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480 TGAACCGG             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579  GAACCGGA            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598           ATAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412            TAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436             AAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.