PlantPromoterDB promoter information of AT2G42210.1
Summary of Gene (AT2G42210.1)
|
Overview
|
Focused view (chromosome 2: 17589642-17590841)
|
Genome position
from initiation codon AT2G42210.3 AT2G42210.4 TSS from cDNA TSS information AT2G42210.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT2G42210.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 10 | + | 17590212 | -430 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | + | 17590213 | -429 |
| TSS clone | A | clone | + | 17590223 | -419 |
| TSS clone | C | clone | + | 17590241 | -401 |
| TSS clone | T | clone | + | 17590244 | -398 |
| TSS clone | T | clone | + | 17590247 | -395 |
| TSS clone | G | clone | + | 17590276 | -366 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTTTCTCT | + | 17590165 | 17590172 | -477 | -470 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TAAATGGGCTA | + | 17590100 | 17590110 | -542 | -532 | |||
| AtREG443 | TAAATGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG386 | AAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG372 | AATGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG581 | ATGGGCTA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| REG | ATAATGGGCCCTAAGAGGCCCACA | + | 17590112 | 17590135 | -530 | -507 | |||
| AtREG546 | ATAATGGG | PPDB Motif | PLACE Motif | ||||||
| AtREG357 | TAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG361 | AATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG391 | ATGGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG400 | TGGGCCCT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG387 | GGGCCCTA | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG411 | AGAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG447 | GAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG482 | AGGCCCAC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG612 | GGCCCACA | DREB1Aox | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | |||
| REG | TAATTGGGCTTT | + | 17590157 | 17590168 | -485 | -474 | |||
| AtREG600 | TAATTGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG418 | AATTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG402 | ATTGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG407 | TTGGGCTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG376 | TGGGCTTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||