version
PlantPromoterDB promoter information of AT2G43120.1

Summary of Gene (AT2G43120.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G43120  TAIR      NCBI 
Gene model AT2G43120.1  
Description pirin, putative; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: stem, flower; CONTAINS InterPro DOMAIN/s: Pirin, C-terminal (InterPro:IPR008778), Pirin (InterPro:IPR012093), Cupin, RmlC-type (InterPro:IPR011051), Pirin, N-terminal (InterPro:IPR003829); BEST Arabidopsis thaliana protein match is: PRN (PIRIN); calmodulin binding (TAIR:AT3G59220.1); Has 5405 Blast hits to 5403 proteins in 856 species: Archae - 43; Bacteria - 2852; Metazoa - 62; Fungi - 147; Plants - 68; Viruses - 0; Other Eukaryotes - 2233 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 17926339-17927538)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G43120.1                      5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G43120.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA17+17927264-75

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+17927264-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTCTATAAATA+1792722617927237-113-102
Y PatchTCCTCTCTCTTCT+1792721817927230-121-109
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGACGTG+1792711117927118-228-221
 AtREG466GTGACGTGABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGGAAGCCCATCATGGCCCACA+1792717617927195-163-144
 AtREG476GAAGCCCA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG635   GCCCATCA          PPDB MotifGCCCA  PLACE Motif 
 AtREG437          ATGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG612            GGCCCACADREB1Aox PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.