version
PlantPromoterDB promoter information of AT2G43350.1

Summary of Gene (AT2G43350.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G43350  TAIR      NCBI 
Gene model AT2G43350.1  
Description Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1.  
#
#

Overview

Focused view (chromosome 2: 18011533-18010334)

Genome position     
from initiation codon
AT2G43360.1         
TSS from cDNA
TSS information
AT2G43350.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G43350.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-18010592-59

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-18010576-43

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAGCCCATTAA-1801064618010657-113-124
 AtREG426TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357   GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396    CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGTTGGCCCATG-1801065918010668-126-135
 AtREG484TTGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490 TGGCCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG504  GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
REGAGATGGGCTTTAA-1801069618010708-163-175
 AtREG572AGATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG378  ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG545     GGCTTTAA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.