version
PlantPromoterDB promoter information of AT2G44040.1

Summary of Gene (AT2G44040.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G44040  TAIR      NCBI 
Gene model AT2G44040.1  
Description dihydrodipicolinate reductase family protein; FUNCTIONS IN: dihydrodipicolinate reductase activity; INVOLVED IN: oxidation reduction, lysine biosynthetic process via diaminopimelate, metabolic process, diaminopimelate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Dihydrodipicolinate reductase, plant (InterPro:IPR011859), Dihydrodipicolinate reductase, bacterial and plant (InterPro:IPR011770), Dihydrodipicolinate reductase (InterPro:IPR000846); BEST Arabidopsis thaliana protein match is: dihydrodipicolinate reductase family protein (TAIR:AT3G59890.1); Has 2046 Blast hits to 2045 proteins in 732 species: Archae - 80; Bacteria - 1476; Metazoa - 2; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 440 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 18224998-18223799)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G44040.1                      5'->3' (-)
Promoter sequence





 
AT2G44050.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G44040.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-18224079-81

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-18224104-106

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTCCGGTTTG-1822413918224149-141-151
 AtREG644TTTCCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  TCCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496   CCGGTTTG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCCGGTTTAT-1822420018224210-202-212
 AtREG534TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598   CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGGTTCAA-1822421418224221-216-223
 AtREG640CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCTGACGGT-1822435318224360-355-362
 AtREG625CTGACGGT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5+18224285AT2G44050.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone+18224255AT2G44050.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCAAACCGGAAA+1822413918224149AT2G44050.1
 AtREG496CAAACCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534  AACCGGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644   ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAAACCGGAA+1822420018224210AT2G44050.1
 AtREG598ATAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534   AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTGAACCG+1822421418224221AT2G44050.1
 AtREG640TTGAACCG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.