version
PlantPromoterDB promoter information of AT2G44270.1

Summary of Gene (AT2G44270.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G44270  TAIR      NCBI 
Gene model AT2G44270.1  
Description ATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: tRNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Uncharacterised protein family UPF0021 (InterPro:IPR000541), PP-loop (InterPro:IPR011063), 2-thiocytidine tRNA biosynthesis protein, TtcA (InterPro:IPR012089); BEST Arabidopsis thaliana protein match is: ATP binding (TAIR:AT1G76170.1); Has 3072 Blast hits to 3023 proteins in 1040 species: Archae - 205; Bacteria - 2091; Metazoa - 125; Fungi - 122; Plants - 38; Viruses - 0; Other Eukaryotes - 491 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 18301153-18299954)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G44270.1                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G44270.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-18300185-32

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-18300184-31

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTCC-1830017318300180-20-27
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGCCGTTT-1830023618300243-83-90
 AtREG500TGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGCAAAGCCCATTTATGGCCCACA-1830025418300275-101-122
 AtREG559CAAAGCCC               PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372   AGCCCATT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386    GCCCATTT           PPDB MotifGCCCA  PLACE Motif 
 AtREG443     CCCATTTA          PPDB MotifGCCCA  PLACE Motif 
 AtREG479           TATGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG437            ATGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG612              GGCCCACADREB1Aox PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTGCCGTTTA-1830029718300305-144-152
 AtREG500TGCCGTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG613 GCCGTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAAGTCAA-1830035118300358-198-205
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.