version
PlantPromoterDB promoter information of AT2G44370.1

Summary of Gene (AT2G44370.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G44370  TAIR      NCBI 
Gene model AT2G44370.1  
Description DC1 domain-containing protein; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT2G17740.1); Has 1603 Blast hits to 573 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 5; Plants - 1571; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 18322004-18320805)

Genome position     
from initiation codon
AT2G44360.1         
TSS from cDNA
TSS information
AT2G44370.1                      5'->3' (-)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G44370.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-18322920-66

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTACTATAAATATATAC-1832294218322957-88-103
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCAATAT-1832306018323067-206-213
 AtREG509CCCAATAT PPDB Motif  PLACE Motif 
REGAAGCGCGT-1832308218323089-228-235
 AtREG492AAGCGCGT PPDB MotifACGCGC  PLACE Motif 
REGTTGACTTT-1832313518323142-281-288
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-18321683AT2G44360.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone-18321693AT2G44360.1
TSS cloneAclone-18321625AT2G44360.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACACGCGCCG-1832174918321758AT2G44360.1
 AtREG385ACACGCGC   PPDB MotifACGCGC  PLACE MotifACACNNG 
 AtREG486 CACGCGCC  PPDB MotifACGCGC  PLACE Motif 
 AtREG538  ACGCGCCG PPDB MotifACGCGC  PLACE Motif 
REGCCACGTCAG-1832180318321811AT2G44360.1
 AtREG419CCACGTCA  PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG440 CACGTCAGABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGAAAGTCAA-1832181518321822AT2G44360.1
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGTTGACTTT-1832195218321959AT2G44360.1
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGAAAAAGCC-1832196218321969AT2G44360.1
 AtREG589AAAAAGCC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.