version
PlantPromoterDB promoter information of AT2G44870.1

Summary of Gene (AT2G44870.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G44870  TAIR      NCBI 
Gene model AT2G44870.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 18502250-18503449)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G44870.1                      5'->3' (+)
Promoter sequence





 
AT2G44860.1         
AT2G44860.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G44870.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+18503119-131
TSS peakG8+18503190-60

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+18503138-112
TSS cloneAclone+18503156-94
TSS cloneAclone+18503181-69

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTTTATA+1850308118503088-169-162
Y PatchTCTCCTTC+1850319418503201-56-49
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTCCGGTTTAA+1850302718503038-223-212
 AtREG644TTTCCGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412   CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473    CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAACCGGTTAAG+1850304618503058-204-192
 AtREG503 TAACCGGTTA   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501TTAACCGGTTAA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG605     CGGTTAAG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-18502512AT2G44860.1, AT2G44860.2
TSS clone peakGclone-18502511AT2G44860.1, AT2G44860.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.