version
PlantPromoterDB promoter information of AT2G46800.1

Summary of Gene (AT2G46800.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G46800  TAIR      NCBI 
Gene model AT2G46800.1  
Description Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis.  
#
#

Overview

Focused view (chromosome 2: 19237128-19238327)

Genome position     
from initiation codon
AT2G46800.2         
TSS from cDNA
TSS information
AT2G46800.1                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G46800.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+19237446-682
TSS peakA13+19237563-565
TSS peakG2+19237861-267
TSS peakA5+19237964-164

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+19237520-608
TSS cloneTclone+19237525-603
TSS cloneGclone+19238008-120

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTATATA+1923753119237538-597-590
Y PatchTCTCTCAT+1923745119237458-677-670
Y PatchTCTCTTCCT+1923757319237581-555-547
Y PatchCCTTCTCTTCCTCTC+1923758919237603-539-525
Y PatchTTCCTCCT+1923786719237874-261-254
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTAAACCG+1923718119237188-947-940
 AtREG511CTAAACCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAAAGCC+1923721919237226-909-902
 AtREG589AAAAAGCC PPDB Motif  PLACE Motif 
REGACCGGTTTG+1923725819237266-870-862
 AtREG436ACCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496 CCGGTTTG PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACGGCCACGTGTT+1923734219237357-786-771
 AtREG531AAAACGGC         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG367      GCCACGTG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG382       CCACGTGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG590        CACGTGTTABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGGGGACCCA+1923742519237432-703-696
 AtREG615GGGACCCAABA PPDB MotifGGGACCC  PLACE Motif 
REGGGGTCAAA+1923777719237784-351-344
 AtREG592GGGTCAAA PPDB Motif  PLACE MotifTTGAC, TTGACC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.