version
PlantPromoterDB promoter information of AT2G46900.1

Summary of Gene (AT2G46900.1)

Organism Arabidopsis thaliana  
Chromosome 2  
Locus AT2G46900  TAIR      NCBI 
Gene model AT2G46900.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix, Nulp1-type (InterPro:IPR006994); Has 3014 Blast hits to 2357 proteins in 239 species: Archae - 2; Bacteria - 96; Metazoa - 1166; Fungi - 321; Plants - 100; Viruses - 47; Other Eukaryotes - 1282 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 2: 19268678-19269877)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT2G46900.1                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT2G46900.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5+19269579-99

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+19269558-120
TSS cloneGclone+19269577-101
TSS cloneTclone+19269578-100
TSS cloneGclone+19269579-99
TSS cloneTclone+19269580-98
TSS cloneAclone+19269581-97
TSS cloneTclone+19269582-96

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCC+1926961819269625-60-53
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGACGTCGTT+1926939119269404-287-274
 AtREG520AAAACGAC       PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG      PPDB Motif  PLACE Motif 
 AtREG493  AACGACGTCGTT PPDB MotifACGT  PLACE MotifACGT 
 AtREG431   ACGACGTCGT  PPDB MotifACGT  PLACE MotifACGT 
REGTAAAACGCC+1926942319269431-255-247
 AtREG564TAAAACGC  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG650 AAAACGCC PPDB MotifAAACG(C/G)  PLACE Motif 
REGACCGGTTTAA+1926949519269504-183-174
 AtREG436ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473  CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCGGTTAAG+1926950919269518-169-160
 AtREG503ACCGGTTA   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501 CCGGTTAA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG605  CGGTTAAG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGAAAACCGGAAA+1926952119269531-157-147
 AtREG542AAAACCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534  AACCGGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644   ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.