version
PlantPromoterDB promoter information of AT3G01440.1

Summary of Gene (AT3G01440.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G01440  TAIR      NCBI 
Gene model AT3G01440.1  
Description oxygen evolving enhancer 3 (PsbQ) family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis, light reaction; LOCATED IN: chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast, oxygen evolving complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbQ (InterPro:IPR008797); BEST Arabidopsis thaliana protein match is: oxygen-evolving enhancer protein 3, chloroplast, putative (PSBQ1) (PSBQ) (TAIR:AT4G21280.2); Has 110 Blast hits to 110 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 167478-168677)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G01440.1                      5'->3' (+)
Promoter sequence




 
AT3G01435.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G01440.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+168437-41

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+168435-43

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACGGCGT+168179168187-299-291
 AtREG524AAACGGCG  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG497 AACGGCGT PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
REGTGTCACGTAAAACGGCACG+168285168303-193-175
 AtREG606TGTCACGT           ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG531        AAAACGGC    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG500         AAACGGCA   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG522           ACGGCACG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG13-168235AT3G01435.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-168241AT3G01435.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCCTC-168205168212AT3G01435.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGTGCCGTTTTACGTGACA-168285168303AT3G01435.1
 AtREG522CGTGCCGT            PPDB Motif  PLACE Motif 
 AtREG500  TGCCGTTT          PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG531   GCCGTTTT         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG606           ACGTGACAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.