PlantPromoterDB promoter information of AT3G01540.4
Summary of Gene (AT3G01540.4)
|
Overview
|
Focused view (chromosome 3: 217142-215943)
|
Genome position
from initiation codon AT3G01540.2 AT3G01540.3 AT3G01550.1 TSS from cDNA TSS information AT3G01540.4 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT3G01540.4
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 115 | - | 216665 | -523 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | G | clone | - | 216665 | -523 |
| TSS clone | G | clone | - | 216664 | -522 |
| TSS clone | A | clone | - | 216663 | -521 |
| TSS clone | T | clone | - | 216660 | -518 |
| TSS clone | C | clone | - | 216654 | -512 |
| TSS clone | A | clone | - | 216643 | -501 |
| TSS clone | C | clone | - | 216634 | -492 |
| TSS clone | T | clone | - | 216633 | -491 |
| TSS clone | A | clone | - | 216584 | -442 |
| TSS clone | C | clone | - | 216583 | -441 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | TTTATAAACC | - | 216691 | 216700 | -549 | -558 |
| Y Patch | CTTTCTCTCTCTT | - | 216630 | 216642 | -488 | -500 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GTGGCCCAAAAGGGCCCAAAA | - | 216753 | 216773 | -611 | -631 | |||
| AtREG445 | GTGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GCCAC, GGGCC, TGGGCY | ||||
| AtREG420 | TGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG373 | GGCCCAAA GGCCCAAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG529 | GCCCAAAA GCCCAAAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG400 | AGGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG392 | GGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| REG | ATAATGGGCCTAG | - | 216787 | 216799 | -645 | -657 | |||
| AtREG546 | ATAATGGG | PPDB Motif | PLACE Motif | ||||||
| AtREG357 | TAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG361 | AATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG354 | ATGGGCCT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG358 | TGGGCCTA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG475 | GGGCCTAG | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| REG | TGTCGTTTT | - | 216873 | 216881 | -731 | -739 | |||
| AtREG569 | TGTCGTTT | PPDB Motif | PLACE Motif | ||||||
| AtREG520 | GTCGTTTT | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||