PlantPromoterDB promoter information of AT3G02468

Summary of Gene (AT3G02468)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G02468 TAIR NCBI
Gene model	AT3G02468
Description	Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF9 represents a conserved upstream opening reading frame relative to major ORF AT3G02470.1

#

Overview

Focused view (chromosome 3: 508815-510014)

`Genome position from initiation codon` `AT3G02468.1 AT3G02470.1 AT3G02470.3 AT3G02470.4 TSS from cDNA TSS information AT3G02468 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G02468

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 389 + 509087 -728

TSS peak A 69 + 509355 -460

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	389	+	509087	-728
TSS peak	`A`	69	+	509355	-460

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone G clone + 508886 -929

TSS clone T clone + 509079 -736

TSS clone C clone + 509081 -734

TSS clone T clone + 509082 -733

TSS clone C clone + 509083 -732

TSS clone C clone + 509084 -731

TSS clone T clone + 509085 -730

TSS clone A clone + 509087 -728

TSS clone C clone + 509088 -727

TSS clone G clone + 509089 -726

TSS clone A clone + 509090 -725

TSS clone A clone + 509091 -724

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`G`	clone	+	508886	-929
TSS clone	`T`	clone	+	509079	-736
TSS clone	`C`	clone	+	509081	-734
TSS clone	`T`	clone	+	509082	-733
TSS clone	`C`	clone	+	509083	-732
TSS clone	`C`	clone	+	509084	-731
TSS clone	`T`	clone	+	509085	-730
TSS clone	`A`	clone	+	509087	-728
TSS clone	`C`	clone	+	509088	-727
TSS clone	`G`	clone	+	509089	-726
TSS clone	`A`	clone	+	509090	-725
TSS clone	`A`	clone	+	509091	-724

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box CTTATATAAAGG + 509047 509058 -768 -757

Y Patch CTCTTTCT + 509061 509068 -754 -747

Y Patch TTTCCTCCTC + 509077 509086 -738 -729

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CTTATATAAAGG`	+	509047	509058	-768	-757
Y Patch	`CTCTTTCT`	+	509061	509068	-754	-747
Y Patch	`TTTCCTCCTC`	+	509077	509086	-738	-729
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG GGGCTATT + 508851 508858 -964 -957

AtREG584 GGGCTATT PPDB Motif GCCCA PLACE Motif

REG TTCACGCG + 508981 508988 -834 -827

AtREG631 TTCACGCG Drought PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`GGGCTATT`		+	508851	508858	-964	-957
	AtREG584	`GGGCTATT`		PPDB Motif	`GCCCA`	PLACE Motif
REG	`TTCACGCG`		+	508981	508988	-834	-827
	AtREG631	`TTCACGCG`	Drought	PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 8 + 509834 AT3G02470.1, AT3G02470.3, AT3G02470.4

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	8	+	509834	AT3G02470.1, AT3G02470.3, AT3G02470.4

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None