PlantPromoterDB promoter information of AT3G02730

Summary of Gene (AT3G02730)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G02730 TAIR NCBI
Gene model	AT3G02730
Description	THIOREDOXIN F-TYPE 1 (TRXF1); FUNCTIONS IN: enzyme activator activity; INVOLVED IN: positive regulation of catalytic activity; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin domain (InterPro:IPR013766), Thioredoxin, conserved site (InterPro:IPR017937), Thioredoxin-like subdomain (InterPro:IPR006662), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATF2; enzyme activator (TAIR:AT5G16400.1); Has 10196 Blast hits to 9837 proteins in 1664 species: Archae - 125; Bacteria - 4240; Metazoa - 1605; Fungi - 639; Plants - 965; Viruses - 3; Other Eukaryotes - 2619 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 579641-578442)

`Genome position from initiation codon` `TSS from cDNA TSS information AT3G02730 5'->3' (-) Promoter sequence AT3G02680.1 AT3G02690.1 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G02730

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 41 - 589675 -84

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	41	-	589675	-84

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone - 589679 -88

TSS clone A clone - 589677 -86

TSS clone C clone - 589676 -85

TSS clone A clone - 589675 -84

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	-	589679	-88
TSS clone	`A`	clone	-	589677	-86
TSS clone	`C`	clone	-	589676	-85
TSS clone	`A`	clone	-	589675	-84

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTCTCTCTCT - 589661 589670 -70 -79

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTCTCTCTCT`	-	589661	589670	-70	-79
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG ACCGAACCG - 589884 589892 -293 -301

AtREG451 ACCGAACC PPDB Motif PLACE Motif

AtREG456 CCGAACCG PPDB Motif AACCG(G/A) PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`ACCGAACCG`		-	589884	589892	-293	-301
	AtREG451	`ACCGAACC`		PPDB Motif		PLACE Motif
	AtREG456	`CCGAACCG`		PPDB Motif	`AACCG(G/A)`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 2 + 579595 AT3G02690.1

TSS peak A 2 + 579617 AT3G02690.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	2	+	579595	AT3G02690.1
TSS peak	`A`	2	+	579617	AT3G02690.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone A clone + 579595 AT3G02690.1

TSS clone T clone + 579605 AT3G02690.1

TSS clone T clone + 579609 AT3G02690.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`A`	clone	+	579595	AT3G02690.1
TSS clone	`T`	clone	+	579605	AT3G02690.1
TSS clone	`T`	clone	+	579609	AT3G02690.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTTTCTCT + 579598 579605 AT3G02690.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTTTCTCT`	+	579598	579605	AT3G02690.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None