version
PlantPromoterDB promoter information of AT3G02810.1

Summary of Gene (AT3G02810.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G02810  TAIR      NCBI 
Gene model AT3G02810.1  
Description protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G16500.1); Has 117506 Blast hits to 98016 proteins in 3367 species: Archae - 83; Bacteria - 17190; Metazoa - 46381; Fungi - 8932; Plants - 19974; Viruses - 807; Other Eukaryotes - 24139 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 611785-610586)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G02810.1                      5'->3' (-)
Promoter sequence

 
AT3G02820.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G02810.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-610985-200

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA2+611536AT3G02820.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+611536AT3G02820.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTACTGGGCTTTAAGGCC+611352611368AT3G02820.1
 AtREG434TACTGGGC          PPDB MotifGCCCA  PLACE Motif 
 AtREG376   TGGGCTTT       PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA      PPDB MotifGCCCA  PLACE Motif 
 AtREG545     GGCTTTAA     PPDB Motif  PLACE Motif 
 AtREG416         TTAAGGCC PPDB Motif  PLACE Motif 
REGTTAATGGGCTTC+611404611415AT3G02820.1
 AtREG396TTAATGGG     PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476    TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATAAACCGGGTCAAA+611436611450AT3G02820.1
 AtREG598ATAAACCG        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG455   AACCGGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG463    ACCGGGTC    PPDB MotifAACCG(G/A), GGGACCC  PLACE Motif 
 AtREG592       GGGTCAAA PPDB Motif  PLACE MotifTTGAC, TTGACC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.