version
PlantPromoterDB promoter information of AT3G02910.1

Summary of Gene (AT3G02910.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G02910  TAIR      NCBI 
Gene model AT3G02910.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Butirosin biosynthesis, BtrG-like (InterPro:IPR013024), AIG2-like (InterPro:IPR009288); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46720.1); Has 210 Blast hits to 210 proteins in 66 species: Archae - 2; Bacteria - 27; Metazoa - 122; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 648986-650185)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G02910.1                      5'->3' (+)
Promoter sequence















 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G02910.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+649811-175
TSS cloneCclone+649813-173
TSS cloneAclone+649814-172
TSS clone peakAclone+649823-163
TSS cloneAclone+649877-109

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGCTATATAAAC+649775649786-211-200
Y PatchTCTCTCTCTCTCTCTTTCTCT+649849649869-137-117
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCACACGT+649683649690-303-296
 AtREG588TCACACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGAAACGCGT+649783649790-203-196
 AtREG633AAACGCGT PPDB MotifAAACG(C/G)  PLACE Motif 
REGTCGGTTTAA+649793649801-193-185
 AtREG514TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473 CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAAAGCCCTA+649813649822-173-164
 AtREG559CAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG651  AAGCCCTA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.