version
PlantPromoterDB promoter information of AT3G03150.1

Summary of Gene (AT3G03150.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G03150  TAIR      NCBI 
Gene model AT3G03150.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 730357-729158)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G03150.1                      5'->3' (-)
Promoter sequence








 
AT3G03160.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G03150.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA182-729454-97

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-729456-99
TSS cloneAclone-729454-97
TSS cloneTclone-729453-96
TSS cloneTclone-729450-93
TSS cloneAclone-729440-83
TSS cloneGclone-729418-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATATATAAGC-729478729490-121-133
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGACACGTGGAT-729545729556-188-199
 AtREG470AGACACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG366 GACACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG382  ACACGTGG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG408   CACGTGGA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG547    ACGTGGATABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGAAACGGCA-729571729578-214-221
 AtREG500AAACGGCA PPDB MotifAAACG(C/G)  PLACE Motif 
REGAACGGCGTC-729586729594-229-237
 AtREG497AACGGCGT  PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG540 ACGGCGTC PPDB Motif  PLACE Motif 
REGTCGGCCCAAAA-729670729680-313-323
 AtREG393TCGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414 CGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373  GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCTTAAATGGGCTGA-729693729713-336-356
 AtREG386AAATGGGC  AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT  AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG443         TAAATGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG609             TGGGCTGA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGACGCGTGT-729734729741-377-384
 AtREG536ACGCGTGTABA, Drought PPDB Motif  PLACE MotifACACNNG 
REGCACGTGGCGG-729745729754-388-397
 AtREG367CACGTGGC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG371 ACGTGGCG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG560  CGTGGCGGABA PPDB MotifCCGAC  PLACE MotifGCCAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+729768AT3G03160.1
TSS clone peakAclone+729800AT3G03160.1
TSS cloneCclone+729806AT3G03160.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTCTT+729771729779AT3G03160.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATCCACGTGTCT+729545729556AT3G03160.1
 AtREG547ATCCACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG382  CCACGTGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG366   CACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG470    ACGTGTCTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
REGTGCCGTTT+729571729578AT3G03160.1
 AtREG500TGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGGACGCCGTT+729586729594AT3G03160.1
 AtREG540GACGCCGT  PPDB Motif  PLACE Motif 
 AtREG497 ACGCCGTT PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
REGTTTTGGGCCGA+729670729680AT3G03160.1
 AtREG529TTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414  TTGGGCCG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG393   TGGGCCGA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTCAGCCCATTTAAGCCCATTT+729693729713AT3G03160.1
 AtREG609TCAGCCCA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT  AGCCCATT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386   GCCCATTT  GCCCATTT PPDB MotifGCCCA  PLACE Motif 
 AtREG443    CCCATTTA          PPDB MotifGCCCA  PLACE Motif 
 AtREG426          TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378           AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGACACGCGT+729734729741AT3G03160.1
 AtREG536ACACGCGTABA, Drought PPDB Motif  PLACE MotifACACNNG 
REGCCGCCACGTGTA+729745729756AT3G03160.1
 AtREG560CCGCCACG    ABA PPDB MotifCCGAC  PLACE MotifGCCAC 
 AtREG371 CGCCACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG367  GCCACGTG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG382   CCACGTGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG453    CACGTGTAABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.