version
PlantPromoterDB promoter information of AT3G03610.1

Summary of Gene (AT3G03610.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G03610  TAIR      NCBI 
Gene model AT3G03610.1  
Description phagocytosis and cell motility protein ELMO1-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: phagocytosis; LOCATED IN: cytoskeleton; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Engulfment and cell motility, ELMO (InterPro:IPR006816); BEST Arabidopsis thaliana protein match is: phagocytosis and cell motility protein ELMO1-related (TAIR:AT1G03620.1); Has 636 Blast hits to 636 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 422; Fungi - 25; Plants - 106; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 868479-869678)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT3G03610.1                      5'->3' (+)
Promoter sequence








 
AT3G03600.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G03610.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+868873-606

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCTC+868864868872-615-607
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCGGGTCGGGTCGG+868620868634-859-845
 AtREG390GTCGGGTCGGGTC   PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
 AtREG383 TCGGGTCGGGTCG  PPDB Motif  PLACE Motif 
 AtREG375  CGGGTCGGGTCGG PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442   GGGTCGGG     PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405    GGTCGGGT    PPDB MotifCCGAC  PLACE MotifCCGAC 
REGCCGGCCCATTT+868668868678-811-801
 AtREG457CCGGCCCA   CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380 CGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361  GGCCCATT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG386   GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGGTAAACCGGAT+868710868720-769-759
 AtREG519GTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAAACCGGGTCG+868723868734-756-745
 AtREG496CAAACCGG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG455  AACCGGGT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG463   ACCGGGTC  PPDB MotifAACCG(G/A), GGGACCC  PLACE Motif 
 AtREG494    CCGGGTCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG10-868568AT3G03600.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-868578AT3G03600.1
TSS cloneAclone-868577AT3G03600.1
TSS cloneAclone-868572AT3G03600.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTC-868588868595AT3G03600.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCGACCCGACCCGAC-868620868634AT3G03600.1
 AtREG375CCGACCCGACCCG   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG383 CGACCCGACCCGA  PPDB Motif  PLACE Motif 
 AtREG390  GACCCGACCCGAC PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
 AtREG405   ACCCGACC     PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442    CCCGACCC    PPDB MotifCCGAC  PLACE MotifCCGAC 
REGAAATGGGCCGG-868668868678AT3G03600.1
 AtREG386AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380  ATGGGCCG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG457   TGGGCCGGCK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATCCGGTTTAC-868710868720AT3G03600.1
 AtREG561ATCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG519   CGGTTTAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGACCCGGTTTG-868723868734AT3G03600.1
 AtREG494CGACCCGG     PPDB Motif  PLACE Motif 
 AtREG463 GACCCGGT    PPDB MotifAACCG(G/A), GGGACCC  PLACE Motif 
 AtREG455  ACCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496    CCGGTTTG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.