version
PlantPromoterDB promoter information of AT3G04160.1

Summary of Gene (AT3G04160.1)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G04160  TAIR      NCBI 
Gene model AT3G04160.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 1599 Blast hits to 1235 proteins in 157 species: Archae - 0; Bacteria - 45; Metazoa - 652; Fungi - 193; Plants - 164; Viruses - 0; Other Eukaryotes - 545 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 3: 1095296-1094097)

Genome position     
from initiation codon
AT3G04170.1         
TSS from cDNA
TSS information
AT3G04160.1                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G04160.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-1094350-54

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTAATGGGCCTAATTAAATGGGC-10943961094418-100-122
 AtREG558CTAATGGG                PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC               PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   ATGGGCCT             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358    TGGGCCTA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360     GGGCCTAA           PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG506      GGCCTAAT          PPDB Motif  PLACE Motif 
 AtREG443              TAAATGGG  PPDB MotifGCCCA  PLACE Motif 
 AtREG386               AAATGGGC PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCGAA-10944271094438-131-142
 AtREG432ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380  ATGGGCCG   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG393   TGGGCCGA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG427    GGGCCGAA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGGGGCTTAT-10945801094587-284-291
 AtREG462GGGCTTAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.