PlantPromoterDB promoter information of AT3G05090.1

Summary of Gene (AT3G05090.1)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G05090 TAIR NCBI
Gene model	AT3G05090.1
Description	transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: PP1/PP2A phosphatases pleiotropic regulator 2 (PRL2) (TAIR:AT3G16650.1); Has 44294 Blast hits to 19880 proteins in 546 species: Archae - 42; Bacteria - 4731; Metazoa - 20434; Fungi - 9164; Plants - 3848; Viruses - 3; Other Eukaryotes - 6072 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 1424573-1423374)

`Genome position from initiation codon` `AT3G05090.2 TSS from cDNA TSS information AT3G05090.1 5'->3' (-) Promoter sequence AT3G05100.1 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G05090.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone peak G clone - 1423664 -941

TSS clone peak T clone - 1423581 -858

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone peak	`G`	clone	-	1423664	-941
TSS clone peak	`T`	clone	-	1423581	-858

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG CCAATAAG - 1423750 1423757 -1027 -1034

AtREG611 CCAATAAG PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`CCAATAAG`		-	1423750	1423757	-1027	-1034
	AtREG611	`CCAATAAG`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 8 + 1424096 AT3G05100.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	8	+	1424096	AT3G05100.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone A clone + 1424096 AT3G05100.1

TSS clone C clone + 1424097 AT3G05100.1

TSS clone G clone + 1424100 AT3G05100.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`A`	clone	+	1424096	AT3G05100.1
TSS clone	`C`	clone	+	1424097	AT3G05100.1
TSS clone	`G`	clone	+	1424100	AT3G05100.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box TACTATAA + 1424063 1424070 AT3G05100.1

Y Patch TCTCTCCTCTTTCT + 1424131 1424144 AT3G05100.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TACTATAA`	+	1424063	1424070	AT3G05100.1
Y Patch	`TCTCTCCTCTTTCT`	+	1424131	1424144	AT3G05100.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG TTTAACCG + 1424005 1424012 AT3G05100.1

AtREG645 TTTAACCG PPDB Motif AACCG(G/A) PLACE Motif CNGTTR