PlantPromoterDB promoter information of AT3G06730.1

Summary of Gene (AT3G06730.1)

Organism	Arabidopsis thaliana
Chromosome	3
Locus	AT3G06730 TAIR NCBI
Gene model	AT3G06730.1
Description	thioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: thylakoid, chloroplast, nucleoid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like subdomain (InterPro:IPR006662), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: Aty2 (Arabidopsis thioredoxin y2); electron carrier/ protein disulfide oxidoreductase (TAIR:AT1G43560.1); Has 10054 Blast hits to 9725 proteins in 1657 species: Archae - 115; Bacteria - 4627; Metazoa - 1415; Fungi - 518; Plants - 866; Viruses - 0; Other Eukaryotes - 2513 (source: NCBI BLink).

#

Overview

Focused view (chromosome 3: 2129376-2130575)

`Genome position from initiation codon` `TSS from cDNA TSS information AT3G06730.1 5'->3' (+) Promoter sequence AT3G06750.1 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT3G06730.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak T 8 + 2123477 -799

TSS peak A 2 + 2124249 -27

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`T`	8	+	2123477	-799
TSS peak	`A`	2	+	2124249	-27

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone + 2124217 -59

TSS clone A clone + 2124221 -55

TSS clone T clone + 2124250 -26

TSS clone A clone + 2124259 -17

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	+	2124217	-59
TSS clone	`A`	clone	+	2124221	-55
TSS clone	`T`	clone	+	2124250	-26
TSS clone	`A`	clone	+	2124259	-17

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TTGACTTT + 2124135 2124142 -141 -134

AtREG632 TTGACTTT PPDB Motif PLACE Motif TTGAC

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TTGACTTT`		+	2124135	2124142	-141	-134
	AtREG632	`TTGACTTT`		PPDB Motif		PLACE Motif	`TTGAC`

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 60 - 2130315 AT3G06750.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	60	-	2130315	AT3G06750.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone G clone - 2130315 AT3G06750.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`G`	clone	-	2130315	AT3G06750.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCTTCTCTCTTCCT - 2130267 2130280 AT3G06750.1

Y Patch CTTCTTCTCTCTCTCTTTTCTTCTT - 2130284 2130308 AT3G06750.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCTTCTCTCTTCCT`	-	2130267	2130280	AT3G06750.1
Y Patch	`CTTCTTCTCTCTCTCTTTTCTTCTT`	-	2130284	2130308	AT3G06750.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None