PlantPromoterDB promoter information of AT3G06770.3

Summary of Gene (AT3G06770.3)

Organism Arabidopsis thaliana  
Chromosome 3  
Locus AT3G06770  TAIR      NCBI 
Gene model AT3G06770.3  
Description glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: response to cyclopentenone, carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT5G49215.1); Has 1737 Blast hits to 1735 proteins in 255 species: Archae - 2; Bacteria - 483; Metazoa - 5; Fungi - 453; Plants - 700; Viruses - 2; Other Eukaryotes - 92 (source: NCBI BLink).  


Focused view (chromosome 3: 2133716-2132517)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AT3G06770.3                      5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

TSS tag distribution(+)

TSS tag distribution(-)


Promoter Summary of AT3G06770.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
TSS peakA8-2137334-718
TSS peakG5-2137122-506

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS cloneTclone-2137129-513
TSS cloneTclone-2136977-361
TSS cloneGclone-2136962-346

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCTCCTTCT-21371602137172-544-556
Y PatchCTTTCTTCT-21373032137311-687-695
Y PatchTCTTCTTCCTTC-21373212137332-705-716

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
TSS peakG4+2132780AT3G06760.1, AT3G06760.2
TSS peakA4+2132808AT3G06760.1, AT3G06760.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS cloneCclone+2132837AT3G06760.1, AT3G06760.2
TSS cloneCclone+2132840AT3G06760.1, AT3G06760.2
TSS cloneTclone+2132857AT3G06760.1, AT3G06760.2
TSS cloneTclone+2132895AT3G06760.1, AT3G06760.2

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTTCC+21328272132837AT3G06760.1, AT3G06760.2
Y PatchTTTCTCTCTCTCTC+21328432132856AT3G06760.1, AT3G06760.2

REG information

TypeSequenceAnnotationGenome positionGene model
REGTACACGTGTGA+21326292132639AT3G06760.1, AT3G06760.2
REGCCAAACCGCGTGAAACGAC+21326832132701AT3G06760.1, AT3G06760.2
 AtREG550CCAAACCG            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG441   AACCGCGT        Drought PPDB Motif  PLACE Motif 
 AtREG502     CCGCGTGA      Drought PPDB Motif  PLACE Motif 
 AtREG631      CGCGTGAA     Drought PPDB Motif  PLACE Motif 
 AtREG576           GAAACGAC PPDB Motif  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.